User Ratings

Your rating: None (1 vote)
Your rating: None (1 vote)
Your rating: None (1 vote)
Add your comments

Cloning of Small RNA Molecules

Sébastien Pfeffer1,  Mariana Lagos‐Quintana1,  Thomas Tuschl1

1The Rockefeller University, New York, New York

Unit Number: 
UNIT 26.4
DOI: 
10.1002/0471142727.mb2604s72
Online Posting Date: 
November, 2005
GO TO THE FULL TEXT:
PDF or HTML at Wiley Interscience
Are you the author of this protocol? Login or register and return to this page.

Abstract

Small RNAs that are derived from dsRNA precursors act as guide RNAs during sequence-specific epigenetic regulation of eukaryotic gene expression. These small regulatory RNAs are between 20 and 30 nucleotides in length, and fall into one or more of the following categories: small interfering RNAs (siRNAs), microRNAs (miRNAs), and heterochromatic siRNAs (hsiRNAs). Procedures to record the profile of small RNAs expressed in cultured cells or tissues are described. The small RNAs are directionally cloned after isolation from total RNA. The methods rely on T4 RNA ligase-based joining of adapter oligonucleotides to the 3¢ and 5¢ termini of the pool of small RNAs. The ligation products are reverse transcribed and PCR-amplified. It is recommended to directionally concatamerize the relatively short PCR products before cloning in order to increase the number of RNA sequences obtained per clone.

Keywords: RNAi; miRNA; siRNA; non-coding RNA; cDNA library

     
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Interscience

Table of Contents

  • Unit Introduction
  • Basic Protocol: Cloning of Short RNA Molecules
  • Alternate Protocol: Cloning of Small RNA Using the Adenylated 3¢-Adapter Oligodeoxynucleotide
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
  • Other Versions
     
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Interscience

Materials

Basic Protocol: Cloning of Short RNA Molecules

 Materials
  • 200 to 1000 µg of total RNA isolated from cultured cells or tissues (UNIT 4.2)
  • Denaturing solution (UNIT 4.2)
  • Water-saturated phenol (UNIT 4.2), pH 4.3
  • Deionized formamide
  • Gel-loading solution (see recipe)
  • 10-well 15% denaturing gel (15 × 7 × 0.15–cm, 50-ml gel volume; see UNIT 2.12; see recipe)
  • Radiolabeled RNA size markers
  • 0.5× TBE (APPENDIX 2)
  • 0.3 M, 0.4 M, and 5 M NaCl (RNase-free)
  • Absolute ethanol
  • RNase-free water
  • 10× phosphatase buffer (New England Biolabs)
  • 20 U/µl alkaline phosphatase (CIP; New England Biolabs)
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol
  • Chloroform
  • 100 µM non-radioactive 5¢-phosphorylated 3¢-adapter oligonucleotide (see UNIT 3.10 and Table 26.4.1; Fig. 26.4.2A,B)
  • 10 µM 32P-labeled 3¢-adapter oligonucleotide (see UNIT 3.10)
  • 10× RNA ligation buffer (see recipe)
  • 50% (v/v) aqueous dimethyl sulfoxide (DMSO)
  • 20 U/µl T4 RNA ligase (New England Biolabs)
  • 20-well 15% acrylamide gel (15 × 17 × 0.08–cm, 30-ml gel volume; see UNIT 2.12; see recipe)
  • 10× PNK buffer (New England Biolabs)
  • 100 mM ATP, pH 7.0
  • 10 U/µl T4 polynucleotide kinase (New England Biolabs)
  • 100 µM reverse transcription (RT) primer (see Table 26.4.1)
  • 0.1 M DTT
  • 5× first-strand buffer (Invitrogen)
  • 10× dNTP solution (dATP, dCTP, dGTP, dTTP, 2 mM each, pH 7.5)
  • 200 U/µl reverse transcriptase (Superscript II, RNase H(-) M-MLV reverse transcriptase, Invitrogen)
  • 150 mM KOH/20 mM Tris base
  • 150 mM HCl
  • 10× PCR buffer (see recipe)
  • 100 µM first PCR 5¢ primer and first PCR 3¢ primer (see Table 26.4.1)
  • 5 U/µl Taq DNA polymerase
  • 2% (w/v) standard agarose gel (UNIT 2.5A)
  • 25-bp DNA ladder (Invitrogen)
  • 100 µM second PCR 5¢ primer and second PCR 3¢ primer (see Table 26.4.1)
  • 20 U/µl BanI restriction endonuclease and 10× NEB buffer 4 (New England Biolabs)
  • 2000 U/µl T4 DNA ligase and 10× DNA ligation buffer (New England Biolabs)
  • 100-bp DNA ladder (New England Biolabs)
  • 2% (w/v) NuSieve (low-melt) agarose gel (Cambrex)
  • 10× TAE (APPENDIX 2)
  • Tris-buffered phenol (UNIT 2.1A), pH 7.8
  • TOPO-TA cloning kit with TOP10 cells and pCR2.1 vector (Invitrogen)
  • 100 µM primer M13 (–20) F (see Table 26.4.1)
  • 100 µM primer M13 R (see Table 26.4.1)
  • QIAquick PCR purification kit (Qiagen)
  • Homogenizer
  • Spectrophotometer and 1-cm quartz cuvette
  • Plastic wrap
  • Phosphorimaging screen and phosphorimager (see APPENDIX 3A)
  • 1.5-ml siliconized Eppendorf-style reaction tubes (Bio Plas)
  • Eppendorf or Speedvac concentrator
  • 500-µl PCR tubes
  • Thermal cycler
  • 360-nm UV transilluminator
  • 96-well thermocycler-compatible microtiter plates
  • Additional reagents and equipment for RNA extraction (UNIT 4.2), cloning and purification (Chapter 1)
 
Table 26.4.1 Oligonucleotides and Their Corresponding Sequencesa

OligonucleotideSequencea

19-nt RNA markerr(CGUACGCGGAAUACUUCGA)
24-nt RNA markerr(CGUACGCGGAAUACUUCGAAAUGU)
33-nt RNA markerr(CCAUCGAUAAAAAAUAUGGAGAGCUUCCCGAAG)
3¢ adapter (see Basic Protocol)rUrUrUAACCGCGAATTCCAG-L
3¢ adapter (see Alternate Protocol)TTTAACCGCGAATTCCAG-L
5¢ adapterACGGAATTCCTCACTrArArA
RT primer, 1st PCR 3¢ primerGACTAGCTGGAATTCGCGGTTAAA
1st PCR 5¢ primerCAGCCAACGGAATTCCTCACTAAA
2nd PCR 3¢ primerGACTAGCTTGGTGCCGAATTCGCGGTTAAA
2nd PCR 5¢ primerGAGCCAACAGGCACCGAATTCCTCACTAAA
M13 –20 F primerGTAAAACGACGGCCAG
M13 R primerCAGGAAACAGCTATGAC

 aA, C, G, T, DNA residues; rA, rC, rG, rU, RNA residues; L, 3¢ hydroxyl blocking group. 3¢-Adapter oligonucleotides with C3- or C7-amino modifiers as blocking groups can be purchased from commercial DNA/RNA synthesis companies.

Alternate Protocol: Cloning of Small RNA Using the Adenylated 3¢-Adapter Oligodeoxynucleotide

 Additional Materials (also see Basic Protocol)
  • Adenosine 5¢-monophosphoric acid (5¢-AMP)
  • Dimethylformamide (DMF)
  • Triphenylphosphine
  • 2,2¢-Dipyridyldisulfide
  • Imidazole
  • Triethylamine
  • Sodium perchlorate
  • Acetone
  • Anhydrous ethyl ether
  • Thin layer chromatography (TLC) cellulose plates with a 254-nm fluorescence indicator (cellulose-F TLC; Merck)
  • 10% (v/v) saturated (NH4)2SO4
  • 80% ethanol
  • 1 M MgCl2
  • 5× adenylate ligation buffer (ATP-free; see recipe)
  • 1.25 mM phosphorylated 3¢-adapter oligodeoxynucleotide (see Table 26.4.1 and UNIT 3.10)
  • 10 µM 32P-labeled 3¢-adapter oligonucleotide (see UNIT 3.10)
  • 30-ml Corex tubes
  • Sorvall centrifuge with SS34 rotor (or equivalent)
  • Vacuum drying oven
  • Glass capillaries
  • 254-nm UV light
  • 13-ml polypropylene tube, 95 × 16.8–mm (Sarstedt)

NOTE: All reagents can be purchased from Sigma and should be at least 99% pure.

     
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Interscience

Figures

  • Figure 26.4.1
    Schematic drawing of the Basic and Alternate Protocols for small RNA cloning.

  • Figure 26.4.2
    Structure of special reagents. (A, B) Structure of two alternative 3¢ blocks of the 3¢-adapter oligonucleotide after chemical synthesis and deprotection. Commercial DNA/RNA synthesis product providers use similar reagents. The C-7 linker in (A) was purchased from Chemgenes as 3¢-TFA MODIFIER C-7 ICAA CPG and used for chemical DNA/RNA synthesis in house. The 3¢ blocking group after deprotection is shown in (B), used during the authors' cloning experiments in 2001. The reagent used for the synthesis was dimethoxytrityl-dimethylbenzyl-succinyl-aminopropyl CPG and was a gift from Brian Sproat. Again, this 3¢-modifier group was coupled to CPG for chemical DNA/RNA synthesis. (C, D) Reagents for the Alternate Protocol. C, ImpA; D, 3¢-adenylated 3¢-adapter oligonucleotide.

  • Figure 26.4.3
    Example of a concatamer sequence after cloning of small RNAs from Drosophila embryos. The lowercase letters represent the vector sequence and the uppercase letters represent concatomer sequence. Constant sequences of the adapter oligonucleotides are highlighted (dark gray, 3¢ adapter, and light gray, 5¢ adapter). The BanI restriction site is underlined.

Literature Cited

Literature Cited
    Ambros, V., Bartel, B., Bartel, D.P., Burge, C.B., Carrington, J.C., Chen, X., Dreyfuss, G., Eddy, S.R., Griffiths-Jones, S., Marshall, M., Matzke, M., Ruvkun, G., and Tuschl, T. 2003. A uniform system for microRNA annotation. RNA 9:277-279.
    Elbashir, S.M., Lendeckel, W., and Tuschl, T. 2001. RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15:188-200.
    Hamilton, A.J. and Baulcombe, D.C. 1999. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286:950-952.
    Lagos-Quintana, M., Rauhut, R., Lendeckel, W., and Tuschl, T. 2001. Identification of novel genes coding for small expressed RNAs. Science 294:853-858.
    Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, W., and Tuschl, T. 2002. Identification of tissue-specific microRNAs from mouse. Curr. Biol. 12:735-739.
    Lagos-Quintana, M., Rauhut, R., Meyer, J., Borkhardt, A., and Tuschl, T. 2003. New microRNAs from mouse and human. RNA 9:175-179.
    Lau, N.C., Lim, L.P., Weinstein, E.G., and Bartel, D.P. 2001. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:858-862.
    Lee, R.C., Feinbaum, R.L., and Ambros, V. 1993. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75:843-854.
    Lohrmann, R. and Orgel, L.E. 1978. Preferential formation of (2¢-5¢)-linked internucleotide bonds in non-enzymatic reactions. Tetrahedron 34:853-855.
    Mukaiyama, T. and Hashimoto, M. 1971. Phosphorylation by oxidation-reduction condensation: Preparation of active phosphorylating reagents. Bull. Chem. Soc. Japan 44:2284.
    Pasquinelli, A.E., Reinhart, B.J., Slack, F., Martindale, M.Q., Kuroda, M.I., Maller, B., Hayward, D.C., Ball, E.E., Degnan, B., Muller, P., Spring, J., Srinivasan, A., Fishman, M., Finnerty, J., Corbo, J., Levine, M., Leahy, P., Davidson, E., and Ruvkun, G. 2000. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature 408:86-89.
    Reinhart, B.J., Slack, F.J., Basson, M., Pasquinelli, A.E., Bettinger, J.C., Rougvie, A.E., Horvitz, H.R., and Ruvkun, G. 2000. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403:901-906.
    Tuschl, T., Zamore, P.D., Lehmann, R., Bartel, D.P., and Sharp, P.A. 1999. Targeted mRNA degradation by double-stranded RNA in vitro. Genes Dev. 13:3191-3197.
     
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Interscience
Looking for Answers?
Do you have tips, tricks, or improvements to share?

Join the Conversation

Post new comment

The content of this field is kept private and will not be shown publicly.
CAPTCHA
This question is for testing whether you are a human visitor and to prevent automated spam submissions.