User Ratings

Your rating: None (2 votes)
Your rating: None
Your rating: None
Add your comments

Epstein‐Barr Virus (EBV): Infection, Propagation, Quantitation, and Storage

Ke Lan1,  Subhash C. Verma1,  Masanao Murakami1,  Bharat Bajaj1,  Erle S. Robertson1

1University of Pennsylvania Medical School, Philadelphia, Pennsylvania

Unit Number: 
Unit 14E.2
DOI: 
10.1002/9780471729259.mc14e02s6
Online Posting Date: 
August, 2007
GO TO THE FULL TEXT:
PDF or HTML at Wiley Online Library
Are you the author of this protocol? Login or register and return to this page.

Abstract

Epstein-Barr virus (EBV) was first reported as the etiological agent of Burkitt's lymphoma in 1964. Since then, EBV has also been associated with nasopharyngeal carcinoma, which is highly prevalent in Southeast Asia, as well as infectious mononucleosis, complications of AIDS, and transplant-related B cell lymphomas. This virus has further been linked with T cell lymphomas and Hodgkin's disease, establishing the concept of a wide spectrum of EBV-associated malignant disorders. So far, there are a number of EBV-infected cell lines established that can be induced for production of infectious viral progeny and that facilitate the study of the mechanism of EBV-related infection, transformation, and oncogenesis. This unit describes procedures for the preparation of EBV virion particles and in vitro infection of cells with EBV. In addition, procedures for quantitation and storage of the virus are provided. Curr. Protoc. Microbiol. 6:14E.2.1-14E.2.21. © 2007 by John Wiley & Sons, Inc.

Keywords: Epstein Barr virus; induction; infection; quantitation; B lymphocyte

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategies for Induction of EBV Replication
  • Basic Protocol 1: Induction of EBV Replication Using Ig Cross-Linking Agents
  • Basic Protocol 2: Induction of EBV Replication Using BZLF1 from a Heterologous Promoter
  • Basic Protocol 3: Induction of EBV Replication Using Phorbol Ester (12-O-Tetradecanoyl-Phorbol-13-Acetate; TPA)
  • Basic Protocol 4: Induction of EBV Replication Using a Combination of TPA and Sodium Butyrate
  • Isolating EBV
  • Basic Protocol 5: Harvesting of EBV from Cell Supernatant
  • Basic Protocol 6: Concentration of EBV by Ultracentrifugation
  • Infecting Cells with EBV
  • Basic Protocol 7: Infection of Human Cells with EBV
  • Basic Protocol 8: Microcell-Mediated EBV Genome Transfer to Mouse Cells
  • Quantitation of EBV
  • Basic Protocol 9: Quantitation of EBV Virions by Quantitative PCR Using DNA of Known Copy Number as Standard
  • Alternate Protocol: Quantitation of EBV Virions by Quantitative PCR via Comparison to Cell Line with Known Viral Copies
  • Long-Term Storage of EBV
  • Basic Protocol 10: Freezing EBV-Infected Cells
  • Basic Protocol 11: Thawing EBV-Infected Cells
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1:  Induction of EBV Replication Using Ig Cross-Linking Agents
 Materials
  • EBV-positive B cells (see Basic Protocol 7): Akata cells infected with GFP-tagged EBV are recommended (Kanda et al., 2004; to obtain cells, contact Dr. Kanda at tkanda@igm.hokudai.ac.jp)
  • Complete RPMI medium containing 10% FBS (see recipe)
  • Anti-IgG antibody
  • Centrifuge with swinging-bucket rotor
  • Additional reagents and equipment for harvesting EBV from cell supernatant (Basic Protocol 5)
Basic Protocol 2:  Induction of EBV Replication Using BZLF1 from a Heterologous Promoter
 Materials
  • EBV-positive B cell line: B95.8 (available from ATCC) or LCL1 or LCL2 (generated in Dr. Erle Robertson's laboratory; erle@mail.med.upenn.edu)
  • Complete RPMI medium containing 10% FBS (see recipe) and serum-free RPMI 1640 medium (e.g., Invitrogen)
  • Phosphate-buffered saline (PBS; appendix 2A)
  • 1µg/ml BZLF1 expression vector in TE buffer, pH 8.0 (appendix 2A) or distilled H2O
  • Centrifuge with swinging-bucket rotor
  • 0.4-cm-gap electroporation cuvette
  • Gene pulser II system (Bio-Rad)
  • Additional reagents and equipment for harvesting EBV from cell supernatant (Basic Protocol 5)

NOTE: B95.8, LCL1, and LCL2 are all EBV-positive B cells lines that can be used as a resources for production of the virus, with no significant difference between them.

Basic Protocol 3:  Induction of EBV Replication Using Phorbol Ester (12-O-Tetradecanoyl-Phorbol-13-Acetate; TPA)
 Materials
  • EBV-positive B cell line: B95.8 (available from ATCC) or LCL1 or LCL2 (generated in Dr. Erle Robertson's laboratory; erle@mail.med.upenn.edu)
  • Phosphate-buffered saline (PBS; appendix 2A)
  • Complete RPMI medium containing 10% FBS (see recipe)
  • 2000× (40 µg/µg/ml) 12-O-tetradecanoyl-phorbol-13-acetate (TPA; Sigma), sterilized by filtration through 0.22-µm membrane
  • Centrifuge with swinging-bucket rotor
  • Additional reagents and equipment for harvesting EBV from cell supernatant (Basic Protocol 5)

NOTE: B95.8, LCL1, and LCL2 are all EBV-positive B cells lines that can be used as a resources for production of the virus, with no significant difference between them.

Basic Protocol 4:  Induction of EBV Replication Using a Combination of TPA and Sodium Butyrate
 Materials
  • EBV-positive B cell line: B95.8 (available from ATCC) or LCL1 or LCL2 (generated in Dr. Erle Robertson's laboratory; erle@mail.med.upenn.edu)
  • Phosphate-buffered saline (PBS; appendix 2A)
  • Complete RPMI 1640 medium containing 10% FBS (see recipe)
  • 2000× (40 µg/µg/ml) 12-O-tetradecanoyl-phorbol-13-acetate (TPA; Sigma), sterilized by filtration through 0.22-µm membrane
  • 3 M sodium butyrate (SB), sterilized by filtration through 0.22-µm membrane
  • Centrifuge with swinging-bucket rotor
  • Additional reagents and equipment for harvesting EBV from cell supernatant (Basic Protocol 5)

NOTE: B95.8, LCL1, and LCL2 are all EBV-positive B cells lines that can be used as a resources for production of the virus, with no significant difference between them.

Basic Protocol 5:  Harvesting of EBV from Cell Supernatant
 Materials
  • Cells induced for EBV replication (Basic Protocols 1 to 4)
  • Dry ice
  • Isopropanol
  • Centrifuge with swinging-bucket rotor
  • 15-ml conical centrifuge tubes
  • Container suitable for resisting extremely cold temperatures
  • 0.45-µm syringe filter
Basic Protocol 6:  Concentration of EBV by Ultracentrifugation
 Materials
  • 70% (v/v) ethanol
  • EBV-containing supernatant (Basic Protocol 5)
  • Phosphate-buffered saline (PBS; appendix 2A)
  • 10-ml ultracentrifuge tube
  • UV light source for sterilization
  • Ultracentrifuge with swinging-bucket rotor (Fig. 14E.2.1C)
  • Refrigerated centrifuge with fixed-angle rotor accommodating 1.7-ml microcentrifuge tubes
Basic Protocol 7:  Infection of Human Cells with EBV
 Materials
  • Human B cell lines (suspension), human epithelial cell lines (adherent), or primary human B cells (appendix 4C)
  • Complete RPMI medium containing 10% FBS (see recipe)
  • Supernatant containing EBV infectious virions (Basic Protocol 5 or 6)
  • 1× trypsin/EDTA solution (e.g., Invitrogen)
  • Complete DMEM medium containing 10% FBS (see recipe)
  • 15-ml conical polypropylene centrifuge tubes
  • Centrifuge with swinging-bucket rotor
  • 75-cm2 tissue culture flasks or 100-mm tissue culture plates
  • 96-well tissue culture plate (optional; for producing lymphoblastoid cell line)

NOTE: Medium containing 10% FBS is not always necessary; lower serum concentrations have also been shown to work well for a number of cell lines.

Basic Protocol 8:  Microcell-Mediated EBV Genome Transfer to Mouse Cells
 Materials
  • EBV-infected (Basic Protocol 7) and EBV-negative human lymphoid cell lines
  • Serum-free RPMI 1640 medium (e.g., Invitrogen)
  • EBV-hyg (hygromycin resistance gene–tagged EBV) or EBV-neo (neomycin resistance gene–tagged EBV)
  • Lipofectamine 2000 transfection reagent (Invitrogen)
  • Fetal bovine serum (FBS; appendix 2A), heat inactivated
  • EBV-A9 selection medium A (see recipe)
  • Colcemid (demecolcine; e.g., Invitrogen or Sigma)
  • Percoll microcell gradient mixture (see recipe)
  • Serum-free DMEM medium (e.g., Invitrogen) containing 100 µg/ml phytohemagglutinin (PHA)
  • A9 cells (mouse B lymphocyte cell line used here as recipient cells; ATCC #CRL-1811) grown as monolayer in 100-mm culture dish
  • 47% (w/v) PEG (mol. wt. 8000)
  • Serum-free DMEM medium (e.g., Invitrogen)
  • Growth medium for A9 cells: complete DMEM medium containing 10% FBS (see recipe)
  • 1× trypsin/EDTA solution (e.g., Invitrogen)
  • EBV-A9 selection medium B (see recipe)
  • 6-well tissue culture plates
  • 15- and 50-ml centrifuge tubes
  • Centrifuge and plate carrier
  • 8-, 5-, and 3-µm pore-size Nucleopore polycarbonate filters (Whatman)
  • 25-cm2 tissue culture flasks
  • 100-mm tissue culture plates
Basic Protocol 9:  Quantitation of EBV Virions by Quantitative PCR Using DNA of Known Copy Number as Standard
 Materials
  • Concentrated EBV virion suspension (Basic Protocol 6)
  • 30% and 60% (w/v) sucrose solutions
  • 20% and 35% (w/v) Nycodenz (e.g., Sigma)
  • 0.5× and 1× phosphate-buffered saline (PBS; see appendix 2A for 1× concentration)
  • Lysis buffer (see recipe)
  • 12:12:1 (v/v/v) phenol:chloroform:isoamyl alcohol
  • 3 M sodium acetate, pH 5.2 (appendix 2A)
  • 100% ethanol, ice-cold
  • Primers for quantitative PCR (Table 14E.2.1)
  • DNA of known copy number as standard for quantitative PCR (Bookout et al., 2006)
  • 15-ml ultracentrifuge tubes
  • Gradient maker
  • Ultracentrifuge
  • 18.5-G needles and syringes
  • MWCO 10,000 dialysis tubing, and dialysis clips
  • 60°C water bath
  • Additional reagents and equipment for quantitative PCR (Bookout et al., 2006)
     
    Table 14E.2.1 Primers Used For the Quantitation of EBV

    RegionsSense (5¢-3¢)Antisense (5¢-3¢)

    Bam CGCAGGGCTCGCAAAGTATAGTGCGGAAGTGACACCAAATA
    Bam ETACTGCCACCAGTACCACAACAGGCCGACATTCTCCAAGATAA
    EBNA2CTCTGCCACCTGCAACACTAATTTGGGGTGCTTTGATGAG
    LMP2TGCAATTTGCCTAACATGGATGGACATGAAGAGCACGAAG
    Bam WCCAGACAGCAGCCAATTGTCGGTAGAAGACCCCCTCTTAC

Alternate Protocol:  Quantitation of EBV Virions by Quantitative PCR via Comparison to Cell Line with Known Viral Copies
 Materials
  • EBV-infected or lymphoblastoid cells (see Basic Protocols 7 and 8)
  • Fetal bovine serum (FBS; appendix 2A)
  • EBV-infected-cell freezing medium (see recipe)
  • Cryotubes
  • Liquid nitrogen or ultracold freezer at –140°C

Basic Protocol 11: Thawing EBV-Infected Cells

 Materials
  • Frozen EBV-infected cells in cryotubes (Basic Protocol 1)
  • Growth medium appropriate for cells used (see Reagents and Solutions)
  • Circular floating tube rack (Bioexpress, http://www.bioexpress.com; cat. no. R-8011-2)
  • 15-ml conical polypropylene centrifuge tubes
  • Centrifuge
  • 25-cm2 tissue culture flasks
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  • Figure 14E.2.1
    (A) Entrance to a Biosafety Level 3 (BSL-3) laboratory. (B) Laminar flow hood with biosafety HEPA filter. (C) Ultracentrifuge with swinging-bucket rotor.

  • Figure 14E.2.2
    Bio-Rad Gene Pulser II System.

  • Figure 14E.2.3
    (A) Components used in this unit, including 0.45-µm filter, different size syringes, and collecting tube for filtering virus. (B) Filtering virus in a laminar-flow hood.

  • Figure 14E.2.4
    Changing the medium in a 96-well plate by aspirating with vacuum filtration system.

  • Figure 14E.2.5
    Schematic diagram showing steps of EBV genome transfer to mouse cells.

  • Figure 14E.2.6
    (A) Typical graph showing Ct value of DNA template used for amplification. Ct value for all four samples is shown in their respective color. (B) Standard curve plotted based on the number of copies calculated based on the Ct value.

  • Figure 14E.2.7
    Lymphoblastoid cell line, (A) 4 weeks post EBV infection and (B) 8 weeks post EBV infection.

Literature Cited

Literature Cited
    Bookout, A.L., Cummins, C.L., Kramer, M.F., Pesola, J.M., and Mangelsdorf, D.J. 2006. High-throughput real-time quantitative reverse-transcription PCR. Curr. Protoc. Mol. Biol. 15.8.1-15.8.24.
    Borza, C.M. and Hutt-Fletcher, L.M. 1998. Epstein-Barr virus recombinant lacking expression of glycoprotein gp150 infects B cells normally but is enhanced for infection of epithelial cells. J. Virol. 72:7577-7582.
    Cantaloube, J.F., Piechaczyk, M., Calender, A., Lenoir, G., Minty, A., Carriere, D., Fischer, E., and Poncelet, P. 1990. Stable expression and function of EBV/C3d receptor following genomic transfection into murine fibroblast L cells. Eur. J. Immunol. 20:409-416.
    Carel, J.C., Frazier, B., Ley, T.J., and Holers, V.M. 1989. Analysis of epitope expression and the functional repertoire of recombinant complement receptor 2 (CR2/CD21) in mouse and human cells. J. Immunol. 143:923-930.
    Cen, H., Williams, P.A., McWilliams, H.P., Breinig, M.C., Ho, M., and McKnight, J.L. 1993. Evidence for restricted Epstein-Barr virus latent gene expression and anti-EBNA antibody response in solid organ transplant recipients with posttransplant lymphoproliferative disorders. Blood 81:1393-1403.
    Chan, A.T., Teo, P.M., and Johnson, P.J. 2002. Nasopharyngeal carcinoma. Ann. Oncol. 13:1007-1015.
    Chan, A.T., Teo, P.M., and Huang, D.P. 2004. Pathogenesis and treatment of nasopharyngeal carcinoma. Semin. Oncol. 31:794-801.
    Daibata, M., Humphreys, R.E., Takada, K., and Sairenji, T. 1990. Activation of latent EBV via anti-IgG-triggered, second messenger pathways in the Burkitt's lymphoma cell line Akata. J. Immunol. 144:4788-4793.
    Davies, A.H., Grand, R.J., Evans, F.J., and Rickinson, A.B. 1991. Induction of Epstein-Barr virus lytic cycle by tumor-promoting and non-tumor-promoting phorbol esters requires active protein kinase C. J. Virol. 65:6838-6344.
    Delecluse, H.J., Hilsendegen, T., Pich, D., Zeidler, R., and Hammerschmidt, W. 1998. Propagation and recovery of intact, infectious Epstein-Barr virus from prokaryotic to human cells. Proc. Natl. Acad. Sci. U.S.A. 95:8245-8250.
    Epstein, M.A., Achong, B.G., and Barr, Y.M. 1964. Virus particles in cultured lymphoblasts from Burkitt's lymphoma. Lancet 15:702-703.
    Fingeroth, J.D., Weis, J.J., Tedder, T.F., Strominger, J.L., Biro, P.A., and Fearon, D.T. 1984. Epstein-Barr virus receptor of human B lymphocytes is the C3d receptor CR2. Proc. Natl. Acad. Sci. U.S.A. 81:4510-4514.
    Fingeroth, J.D., Clabby, M.L., and Strominger, J.D. 1988. Characterization of a T-lymphocyte Epstein-Barr virus/C3d receptor (CD21). J. Virol. 62:1442-1427.
    Fingeroth, J.D., Benedict, M.A., Levy, D.N., and Strominger, J.L. 1989. Identification of murine complement receptor type 2. Proc. Natl. Acad. Sci. U.S.A. 86:242-246.
    Fischer, E., Delibrias, C., and Kazatchkine, M.D. 1991. Expression of CR2 (the C3dg/EBV receptor, CD21) on normal human peripheral blood T lymphocytes. J. Immunol. 146:865-869.
    Fujiwara, S. and Ono, Y. 1995. Isolation of Epstein-Barr virus-infected clones of the human T-cell line MT-2: Use of recombinant viruses with a positive selection marker. J. Virol. 69:3900-3903.
    Gradoville, L., Kwa, D., El-Guindy, A., and Miller, G. 2002. Protein kinase C–independent activation of the Epstein-Barr virus lytic cycle. J. Virol. 76:5612-5626.
    Haddad, R.S. and Hutt-Fletcher, L.M. 1989. Depletion of glycoprotein gp85 from virosomes made with Epstein-Barr virus proteins abolishes their ability to fuse with virus receptor-bearing cells. J. Virol. 63:4998-5005.
    Hammerschmidt, W. and Sugden, B. 2004. Epstein-Barr virus sustains Burkitt's lymphomas and Hodgkin's disease. Trends Mol. Med. 10:331-336.
    Kanda, T., Yajima, M., Ahsan, N., Tanaka, M., and Takada, K. 2004. Production of high-titer Epstein-Barr virus recombinants derived from Akata cells by using a bacterial artificial chromosome system. J. Virol. 78:7004-7015.
    Kelleher, Z.T., Fu, H., Livanos, E., Wendelburg, B., Gulino, S., and Vos, J.M. 1998. Epstein-Barr-based episomal chromosomes shuttle 100 kb of self-replicating circular human DNA in mouse cells. Nat. Biotechnol. 16:762-768.
    Kelleher, Z.T., Fu, H., Livanos, E., Wendelburg, B., Gulino, S., and Vos, J.M. 1998. Epstein-Barr-based episomal chromosomes shuttle 100 kb of self-replicating circular human DNA in mouse. Nat. Biotechnol. 16:762-768.
    Kiss, C., Nishikawa, J., Takada, K., Trivedi, P., Klein, G., and Szekely, L. 2003. T cell leukemia I oncogene expression depends on the presence of Epstein-Barr virus in the virus-carrying Burkitt lymphoma lines. Proc. Natl. Acad. Sci. U.S.A. 100:4813-4818.
    Kruh, J. 1982. Effects of sodium butyrate, a new pharmacological agent, on cells in culture. Mol. Cell Biochem. 42:65-82.
    Kugoh, H., Mitsuya, K., Meguro, M., Shigenami, K., Schulz, T.C., and Oshimura, M. 1999. Mouse A9 cells containing single human chromosomes for analysis of genomic imprinting. DNA Res. 6:165-172.
    Lan, K., Kuppers, D.A., Verma, S.C., Sharma, N., Murakami, M., and Robertson, E.S. 2005. Induction of Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen by the lytic transactivator RTA: A novel mechanism for establishment of latency. J. Virol. 79:7453-7465.
    Lazdins, J., Zompetta, C., Grimaldi, S., Barile, G., Venanzoni, M., Frati, L., and Faggioni, A. 1987. TPA induction of Epstein-Barr virus early antigens in Raji cells is blocked by selective protein kinase-C inhibitors. Int. J. Cancer 40:846-849.
    Lear, A.L., Rowe, M., Kurilla, M.G., Lee, S., Henderson, S., Kieff, E., and Rickinson, A.B. 1992. The Epstein-Barr virus (EBV) nuclear antigen 1 BamHI F promoter is activated on entry of EBV-transformed B cells into the lytic cycle. J. Virol. 66:7461-7468.
    Lee, W., Hwang, Y.H., Lee, S.K., Subramanian, C., and Robertson, E.S. 2001. An Epstein-Barr virus isolated from a lymphoblastoid cell line has a 16-kilobase-pair deletion which includes gp350 and the Epstein-Barr virus nuclear antigen 3A. J. Virol. 75:8556-8568.
    Levy, S., Todd, S.C., and Maecker, H.T. 1998. CD81 (TAPA-1): A molecule involved in signal transduction and cell adhesion in the immune system. Annu. Rev. Immunol. 16:89-109.
    Li, Q.X., Young, L.S., Niedobitek, G., Dawson, C.W., Birkenbach, M., Wang, F., and Rickinson, A.B. 1992. Epstein-Barr virus infection and replication in a human epithelial cell system. Nature 356:347-350.
    Longnecker, R. and Miller, C.L. 1996. Regulation of Epstein-Barr virus latency by latent membrane protein 2. Trends Microbiol. 4:38-42.
    Miller, C.L., Lee, J.H., Kieff, E., Burkhardt, A.L., Bolen, J.B., and Longnecker, R. 1994. Epstein-Barr virus protein LMP2A regulates reactivation from latency by negatively regulating tyrosine kinases involved in sIg-mediated signal transduction. Infect Agents Dis. 3:128-136.
    Miller, G. 1989. The switch between EBV latency and replication. Yale J. Biol. Med. 62:205-213.
    Molesworth, S.J., Lake, C.M., Borza, C.M., Turk, S.M., and Hutt-Fletcher, L.M. 2000. Epstein-Barr virus gH is essential for penetration of B cells but also plays a role in attachment of virus to epithelial cells. J. Virol. 74:6324-6332.
    Robertson, E. and Kieff, E. 1995. Reducing the complexity of the transforming Epstein-Barr virus genome to 64 kilobase pairs. J. Virol. 69:983-993.
    Speck, P., Callen, D.F., and Longnecker, R. 2003. Absence of the Epstein-Barr virus genome in breast cancer-derived cell lines. J. Natl. Cancer Inst. 95:1253-1254.
    Takada, K. and Ono, Y. 1989. Synchronous and sequential activation of latently infected Epstein-Barr virus genomes. J. Virol. 63:445-449.
    Tomkinson, B., Robertson, E., and Kieff, E. 1993a. Epstein-Barr virus nuclear proteins EBNA-3A and EBNA-3C are essential for B-lymphocyte growth transformation. J. Virol. 67:2014-2025.
    Tomkinson, B., Robertson, E., Yalamanchili, R., Longnecker, R., and Kieff, E. 1993b. Epstein-Barr virus recombinants from overlapping cosmid fragments. J. Virol. 67:7298-7306.
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library
Looking for Answers?
Do you have tips, tricks, or improvements to share?

Join the Conversation

Post new comment

The content of this field is kept private and will not be shown publicly.
CAPTCHA
This question is for testing whether you are a human visitor and to prevent automated spam submissions.