Molecular Biology > Preparation and Analysis of DNA and RNA

User Ratings

Your rating: None
Your rating: None
Your rating: None
 Add your comments

Cloning of Large Positive‐Strand RNA Viruses

Valera V. Peremyslov1,  Valerian V. Dolja1

1Oregon State University, Corvallis, Oregon

Publication Name: 
Current Protocols in Microbiology
Unit Number: 
Unit 16F.1
DOI: 
10.1002/9780471729259.mc16f01s7
Online Posting Date: 
November, 2007
GO TO THE FULL TEXT:
PDF or HTML at Wiley Online Library
Are you the author of this protocol? Login or register and return to this page.

Abstract

Full-length, biologically active cDNA clones of the positive-strand RNA plant viruses are indispensable for investigating the functions of viral genes and control elements as well as generating virus-derived gene expression and silencing vectors. Even though engineering of such clones for 4- to 10-kb viral RNAs has become routine, it remains a challenging task for 15- to 20-kb RNA genomes of the monopartite viruses in a family Closteroviridae. This unit describes strategic considerations and techniques used to generate an infectious cDNA clone of a closterovirus. The use of agroinfection to improve specific infectivity of the resulting clone is also explained. Curr. Protoc. Microbiol. 7:16F.1.1-16F.1.26. © 2007 by John Wiley & Sons, Inc.

Keywords: RNA virus; full-length clone; cDNA; agroinfection

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Isolation of Single-Stranded Viral RNAs
  • Basic Protocol 2: Isolation of Double-Stranded RNA from Virus-Infected Plants
  • Basic Protocol 3: Primer-Ligation Method for Mapping the 3¢ End of the Viral RNA
  • Alternate Protocol 1: Polyadenylation Method for Mapping the 3¢ End of the Viral RNA
  • Basic Protocol 4: RLM-RACE Method for Mapping the 5¢ End of the Viral RNA
  • Alternate Protocol 2: Method Using Polyadenylation of Double-Stranded RNA for Mapping the 5¢-end End of Viral RNA
  • Basic Protocol 5: Adding Ribozyme to the 3¢ End of the Viral cDNA
  • Basic Protocol 6: Adding a Sequence of RNA Polymerase Promoter to the 5¢ End of the Viral cDNA
  • Basic Protocol 7: RT-PCR Amplification and Cloning of the Internal Part of Viral RNA
  • Basic Protocol 8: Conventional Synthesis and Cloning of cDNAs: Final Assembly of the Full-Length Clone
  • Basic Protocol 9: Agroinoculation of N. benthamiana Plants
  • Support Protocol 1: Transformation of A. tumafaciens by Electroporation
  • Support Protocol 2: Preparation of Electrocompetent A. tumefaciens Cells
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Isolation of Single-Stranded Viral RNAs

 Materials
  • 5 mg/ml virus suspension of interest
  • 10% (w/v) SDS (DNase and RNase free; Bio-Rad)
  • Neutral saturated phenol (EMD Chemicals)
  • Neutral phenol (EMD Chemicals)/chloroform/isoamyl alcohol mixture (25:24:1)
  • Chloroform/isoamyl alcohol (24:1)
  • 7.5 M ammonium acetate
  • 100% and 70% (v/v) ethanol (cold)
  • Sterile nuclease-free water (see appendix 2A for DEPC-treated solutions or purchase commercially)
  • 1.5-ml microcentrifuge tube
  • Refrigerated microcentrifuge
  • Vacuum evaporator (e.g., SpeedVac concentrator, Thermo Scientific)
  • Additional reagents and equipment for performing agarose gel electrophoresis (Voytas, 2000) and spectrophotometrically quantifying nucleic acids (Gallagher, 2004)

Basic Protocol 2: Isolation of Double-Stranded RNA from Virus-Infected Plants

 Materials
  • 1× STE buffer (see recipe)
  • SDS, DNase- and RNase-free (Bio-Rad)
  • Phenol equilibrated with 1× STE buffer (see recipe for buffer)
  • 7.5 molar ammonium acetate
  • 95% (v/v) ethanol
  • CF-11 cellulose (Whatman)
  • 1× STE(see recipe)/15% ethanol
  • Nuclease-free water (see appendix 2A for DEPC-treated solutions or purchase commercially)
  • Mortar and pestle, chilled in ice
  • 50-ml conical, polypropylene centrifuge tubes
  • 5-ml polypropylene columns (Qiagen)
  • Additional reagents and equipment for performing agarose gel electrophoresis (Voytas, 2000) and spectrophotometrically quantifying nucleic acids (Gallagher, 2004)

Basic Protocol 3: Primer-Ligation Method for Mapping the 3¢ End of the Viral RNA

 Materials
  • 100 pmol/µl oligonucleotide PCR primers, in sterile water: C-dG-PCR and dG-PCR, and 5-p20-Nde primer (see Table 16F.1.1)
     
    Table 16F.1.1 Primers Used in Cloning Large Positive-Strand RNA Plant Viruses
    PrimerSequence (5¢ to 3¢)
    C-dG-PCRGGATCCGAGCTCGAATTCGC
    dG-PCRGCGAATTCGAGCTCGGATCC
    dT-SacGGTGAGCTCTTTTTTTTTTTTTTTTTT
    5-p20-NdeGCCATATGACTAGCTCTGTCGAAC
    C-BYV-BglIITACGAGAGATCTCGTAAGCTTCAT
    5-35STAGAGCTCAACATGGTGGAGCAC
    3-35S-virGGATGGTTAAAAACTGCTCTCCAAATGAAATGAACTTCC
    5-vir-35SCATTTCATTTGGAGAGCAGTTTTTAACCATCCTTC
    3BYV-RibTACCCGGGCCGTTTCGTCCTCACGGACTCATCAGAAGACATGTGAATCATGTCTTGACGGCCCTTATTTTTTCTTC
    BYV-BstEIIGTGACGGAGGTGACCTACCTGCC
  • 10 mM ATP: prepared using 100 µl 100 mM ATP (Fermentas) and 900 µl sterile nuclease-free water; store in 50-µl aliquots up to a few months at –20°C
  • 10× T4 polynucleotide kinase buffer (Fermentas)
  • 10 U/µl T4 polynucleotide kinase (Fermentas)
  • Nuclease-free water (see appendix 2A for DEPC-treated solutions or purchase commercially)
  • 7.5 M ammonium acetate
  • 100% ethanol
  • 1 µg/µl viral ssRNA (Basic Protocol 1)
  • 10× T4 RNA ligase buffer (Fermentas)
  • 10 U/µl T4 RNA ligase (Fermentas)
  • Neutral phenol (EMD Chemicals)/chloroform/isoamyl alcohol mixture (25:24:1)
  • Chloroform/isoamyl alcohol (24:1)
  • 5× First-Strand synthesis buffer (Invitrogen)
  • 4 mM (each) dNTP mixture: prepared using 8 µl of each of four 100 mM dNTPs (Promega) and 168 µl sterile RNase-free water; store up to a few months at –20°C
  • 100 mM dithiothreitol (DTT)
  • 200 U/µl SuperScript II reverse transcriptase
  • 10× Taq extender buffer (Stratagene)
  • Taq extender PCR additive (Stratagene)
  • 5 U/µl Taq DNA polymerase
  • Restriction endonucleases: e.g., BamHI (for sites in dG-PCR and C-dG-PCR primers) and NdeI (for sites in 5-p20-Nde primer)
  • High-copy plasmid cloning vector (e.g., pGEM plasmid series; Promega)
  • 1.5-ml microcentrifuge tubes
  • PCR tubes
  • Thermal cycler (e.g., PTC-100 thermocycler; Bio-Rad)
  • Additional reagents and equipment for performing agarose gel electrophoresis (Voytas, 2000), digestion of DNA with restriction endonucleases (Bloch and Grossmann, 1995), and cloning DNA

Alternate Protocol 1: Polyadenylation Method for Mapping the 3¢ End of the Viral RNA

 Materials
  • 1 µg/ml viral ssRNA (Basic Protocol 1)
  • 5× yeast poly(A) polymerase buffer (USB)
  • 10 mM ATP: prepared using 100 µl 100 mM ATP (Fermentas) and 900 µl sterile nuclease-free water; store in 50-µl aliquots up to a few months at –20°C
  • 600 U/µl yeast poly(A) polymerase (USB)
  • Neutral phenol (EMD Chemicals)/chloroform/isoamyl alcohol mixture (25:24:1)
  • Chloroform/isoamyl alcohol mixture (24:1)
  • 7.5 M ammonium acetate
  • 100% ethanol
  • Nuclease-free water (see appendix 2A for DEPC-treated solutions or purchase commercially)
  • 100 pmol/µl oligonucleotide primers in sterile water: dT-Sac, 5-p20-Nde sequence specific primer (see Table 16F.1.1)
  • 4 mM (each) dNTP mixture: prepared using 8 µl of each of four 100 mM dNTPs (Promega) and 168 µl sterile RNase-free water; store up to a few months at –20°C
  • 5× First-Strand synthesis buffer (Invitrogen)
  • 100 mM dithiothreitol (DTT)
  • 200 U/µl SuperScript II RT (Invitrogen)
  • 10× Taq extender buffer (Stratagene)
  • Taq extender PCR additive (Stratagene)
  • Taq DNA polymerase
  • Restriction enzymes (e.g., SacI and NdeI)
  • High-copy plasmid cloning vector (e.g., pGEM plasmid series; Promega)
  • 0.6-ml microcentrifuge tubes
  • PCR tubes
  • Thermal cycler (e.g., PTC-100 thermocycler; Bio-Rad)
  • Additional reagents and equipment for performing agarose gel electrophoresis (Voytas, 2000), digestion of DNA with restriction endonucleases (Bloch and Grossman, 1995), and cloning DNA (Sambrook and Russell, 2001)

Basic Protocol 4: RLM-RACE Method for Mapping the 5¢ End of the Viral RNA

 Materials
  • 1 µg/µl viral ssRNA (Basic Protocol 1)
  • Nuclease-free water (see appendix 2A for DEPC-treated solutions or purchase commercially)
  • FirstChoice RLM-RACE kit (Ambion) including:
    • 10× calf intestine alkaline phosphatase buffer
    • calf intestine alkaline phosphatase
    • 10× tobacco acid pyrophosphatase buffer
    • tobacco acid pyrophosphatase
    • 5¢ RACE adapter
    • Random primer
    • 10× RNA ligation buffer
    • T4 RNA ligase
    • 5¢RACE outer primer
  • Neutral phenol (EMD Chemicals)/chloroform/isoamyl alcohol mixture (25:24:1)
  • Chloroform/isoamyl alcohol mixture (24:1)
  • 7.5 M ammonium acetate
  • Isopropanol
  • 10× Taq extender buffer (Stratagene)
  • 4 mM (each) dNTP mixture: prepared using 8 µl of each of four 100 mM dNTPs (Promega) and 168 µl sterile RNase-free water; store up to a few months at –20°C
  • 100 mM dithiothreitol (DTT)
  • 200 U/µl SuperScript II RT (Invitrogen)
  • Sequence-specific primer carrying a convenient restriction site at its 5¢ end (e.g., C-BYV-BglII; see Table 16F.1.1)
  • Taq extender PCR additive (Stratagene)
  • 5 U/µl Taq DNA Polymerase
  • High-copy plasmid cloning vector (e.g., pGEM plasmid series; Promega)
  • 0.6-ml microcentrifuge tubes
  • PCR tubes
  • Thermal cycler (e.g., PTC-100 thermocycler; Bio-Rad)
  • Additional reagents and equipment for performing agarose gel electrophoresis (Voytas, 2000), digestion of DNA with restriction endonucleases (Bloch and Grossman, 1995), and cloning DNA (Sambrook and Russell, 2001)

Basic Protocol 5: Adding Ribozyme to the 3¢ End of the Viral cDNA

 Materials
  • 10× Taq extender buffer (Stratagene)
  • 4 mM (each) dNTP mixture: commercially prepared using 8 µl of each of four 100 mM dNTPs (Promega) and 168 µl sterile RNase-free water; store up to a few months at –20°C
  • 100 pmol/µl oligonucleotide PCR primers, in sterile water: 5¢ sequence-specific primer BYV-BstEII, ribozyme-encoding primer 3BYV-Rib (see Table 16F.1.1)
  • Taq extender PCR additive (Stratagene)
  • Taq DNA polymerase
  • Nuclease-free water (see appendix 2A for DEPC-treated solutions or purchase commercially)
  • Plasmid vector containing viral cDNA (see Basic Protocol 3, step 17 or Alternate Protocol 1, step 14)
  • Restriction endonucleases (SmaI or XmaI and BstEII)
  • Modified plasmid vector (see Fig. 16F.1.1, steps 2 and 3): e.g., pCB301 mini-binary vector provided by Dr. D. J. Oliver (see Xiang et al., 1999) with added NOS terminator sequence and modified polylinker (see Strategic Planning)
  • PCR tubes
  • Thermal cycler (e.g., PTC-100 thermocycler; Bio-Rad)
  • Additional reagents and equipment for performing agarose gel electrophoresis (Voytas, 2000), digestion of DNA with restriction endonucleases (Bloch and Grossman, 1995), and cloning DNA (Sambrook and Russell, 2001)

Basic Protocol 7: RT-PCR Amplification and Cloning of the Internal Part of Viral RNA

 Materials
  • ~1 µg/µl viral ssRNA (Basic Protocol 1)
  • Nuclease-free water (see appendix 2A for DEPC-treated solutions or purchase commercially)
  • 100 pmol/µl oligonucleotide primers (see Table 16F.1.1): 3¢ and 5¢ sequence-specific primers
  • First-Strand synthesis buffer (Invitrogen)
  • 4 mM (each) 4 mM dNTP mixture: prepared using 8 µl of each of four 100 mM dNTPs (Promega) and 168 µl sterile RNase-free water; store up to a few months at –20°C
  • 100 mM dithiothreitol (DTT)
  • 200 U/µl SuperScript II RT (Invitrogen)
  • 10× Taq extender buffer
  • 5 U/µl Taq extender PCR additive (Stratagene)
  • 5 U/µl Taq DNA Polymerase
  • Restriction enzymes appropriate for sites near the ends of the PCR product
  • Low-copy plasmid vector (e.g., see pCB301 derivative shown in Fig. 16F.1.1, step 5; modified to carry the viral 5¢ and 3¢ fragments spliced to 35S promoter and NOS terminator regulatory elements; Basic Protocol 6)
  • 0.6-ml microcentrifuge tubes
  • PCR tubes
  • Thermal cycler (e.g., PTC-100 thermocycler; Bio-Rad)
  • Additional reagents and equipment for performing agarose gel electrophoresis (Voytas, 2000), digestion of DNA with restriction endonucleases (Bloch and Grossmann, 1995), cloning DNA (Sambrook and Russell, 2001), and purifying digested DNA from agarose gels (Moore et al., 2002)

Basic Protocol 8: Conventional Synthesis and Cloning of cDNAs: Final Assembly of the Full-Length Clone

 Materials
  • Nuclease-free water (see appendix 2A for DEPC-treated solutions or purchase commercially)
  • 1 µg/µl viral ssRNA (Basic Protocol 1)
  • Sequence-specific primer
  • First-Strand synthesis buffer (Invitrogen)
  • 4 mM (each) dNTP mixture: prepared using 8 µl of each of four 100 mM dNTPs (Promega) and 168 µl sterile RNase-free water; store up to a few months at –20°C
  • 100 mM dithiothreitol DTT
  • 200 U/µl SuperScript II RT (Invitrogen)
  • 10× E. coli DNA ligase buffer (Invitrogen)
  • 3 U/µl RNase H (Invitrogen)
  • 10 U/µl E. coli DNA ligase (Invitrogen)
  • 10 U/µl E. coli DNA polymerase (Invitrogen)
  • Neutral phenol (EMD Chemicals)/chloroform/isoamyl alcohol (25:24:1)
  • Chloroform/isoamyl alcohol (24:1)
  • 7.5 M ammonium acetate
  • 100% and 70% (v/v) ethanol
  • 0.6-ml microcentrifuge tubes
  • Vacuum source
  • Additional reagents and equipment for performing agarose gel electrophoresis (Voytas, 2000), digestion of DNA with restriction endonucleases (Bloch and Grossmann, 1995), and cloning DNA (Sambrook and Russell, 2001)

Basic Protocol 9: Agroinoculation of N. benthamiana Plants

 Materials
  • A. tumefaciens C58 GV2260 carrying viral cDNA cultured on agar plates (Support Protocol 1)
  • LB medium (appendix 4A) supplemented with 25 µg/ml kanamycin, 12.5 µg/ml rifampicin and 25 µg/ml streptomycin (see appendix 4A)
  • LB medium (appendix 4A) supplemented with 25 µg/ml kanamycin, 12.5 µg/ml rifampicin and 25 µg/ml streptomycin (see appendix 4A), 10 mM MES, and 20 µM acetosyringone (see recipes for stock solutions)
  • Agrobacterium induction solution (see recipe)
  • 3 to 4 week old (6 to 8 leaf stage) N. benthamiana plants (grown from seed)
  • 28°C shaking incubator
  • Spectrophotometer
  • 3-ml syringe without a needle

Support Protocol 1: Transformation of A. tumafaciens by Electroporation

 Materials
  • Electrocompetent A. tumefaciens C58 GV2260, frozen culture (Support Protocol 2)
  • Binary vector carrying viral cDNA (Basic Protocol 8)
  • LB broth (appendix 4A)
  • LB agar plates supplemented with 25 µg/ml kanamycin, 12.5 µg/ml rifampicin and 25 µg/ml streptomycin (see appendix 4A)
  • Electroporation cuvette (standard 2-mm electrode gap; electroporator specific), ice cold
  • Electroporator (e.g., BTX ECM 630 electroporator; BTX Instrument Division, Harvard Apparatus)
  • 28°C incubator
  • 14-ml sterile, polypropylene tubes

Support Protocol 2: Preparation of Electrocompetent A. tumefaciens Cells

 Materials
  • A. tumefaciens C58 GV2260
  • LB agar plate supplemented with 25 µg/ml of rifampicin and 50 µg/ml of streptomycin (see appendix 4A)
  • LB medium supplemented with 25 µg/ml rifampicin and 50 µg/ml streptomycin (see appendix 4A)
  • Sterile, distilled water, ice cold
  • 20% (v/v) glycerol, sterile and ice cold: autoclave and store up to 1 year at 4°C
  • 28°C shaking incubator
  • Refrigerated centrifuge
Looking for materials?  Suppliers Guide
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  • Figure 16F.1.1
    Diagram showing consecutive steps (and their associated Protocols) for generating a full-length cDNA clone for beet yellow virus (BYV) in a mini-binary plasmid. Dotted boxes represent viral cDNA. Restriction sites used for cloning: A, SacI; B, BglII; X, XbaI; N, SnaBI; T, BstEII; S, SmaI; K, KpnI. Other abbreviations: 5¢ and 3¢, 5¢ and 3¢ termini of BYV cDNA, respectively; 35S, cauliflower mosaic virus (CaMV) 35S promoter; NOS, nopaline synthase terminator; RB and LB, transferred DNA (T-DNA) right border and left border, respectively; Rz, ribozyme sequence.

    View Image
  • Figure 16F.1.2
    NOS terminator sequence.

    View Image
  • Figure 16F.1.3
    Diagram showing consecutive steps of the PCR-assisted generation of the fusion between 35S RNA polymerase promoter and 5¢-terminal region of the viral cDNA. The dotted boxes represent viral cDNA, while the cross-hatched arrows correspond to the 35S promoter.

    View Image

Literature Cited

Literature Cited
    Almazan, F., Gonzalez, J.M., Penzes, Z., Izeta, A., Calvo, E., Plana-Duran, J., and Enjuanes, L. 2000. Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proc. Natl. Acad. Sci. U.S.A. 97:5516-5521.
    Ayllon, M.A., Gowda, S., Satyanarayana, T., Karasev, A.V., Adkins, S., Mawassi, M., Guerri, J., Moreno, P., and Dawson, W.O. 2003. Effects of modification of the transcription initiation site context on citrus tristeza virus subgenomic RNA synthesis. J. Virol. 77:9232-9243.
    Bloch, K.D. and Grossmann, B. 1995. Digestion of DNA with restriction endonuclease. Curr. Protoc. Mol. Biol.31:3.1.1-3.1.21.
    Chapman, E.J., Prokhnevsky, A.I., Gopinath, K., Dolja, V.V., and Carrington, J.C. 2004. Viral RNA silencing suppressors inhibit the microRNA pathway at an intermediate step. Genes Dev. 18:1179-1186.
    Chiba, M., Reed, J.C., Prokhnevsky, A.I., Chapman, E.J., Mawassi, M., Koonin, E.V., Carrington, J.C., and Dolja, V.V. 2006. Diverse suppressors of RNA silencing enhance agroinfection by a viral replicon. Virology 346:7-14.
    Dolja, V.V. 2003. Beet yellows virus: The importance of being different. Mol. Plant Pathol. 4:91-98.
    Dolja, V.V. and Atabekov, J.G. 1987. The structure of barley stripe mosaic virus double-stranded RNAs. FEBS Lett. 214:313-316.
    Dolja, V.V., Kreuze, J.F., and Valkonen, J.P. 2006. Comparative and functional genomics of closteroviruses. Virus Res. 117:38-51.
    Gallagher, S.R. 2004. Quantitation of DNA and RNA with absorption and fluorescence spectroscopy. Curr. Protoc. Mol Biol. 76:A.3D.1-A.3D.12. John Wiley & Sons Hoboken N.J.
    Hagiwara, Y., Peremyslov, V.V., and Dolja, V.V. 1999. Regulation of closterovirus gene expression examined by insertion of a self-processing reporter and by northern hybridization. J. Virol. 73:7988-7993.
    Haseloff, J. and Gerlach, W.L. 1988. Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature 334:585-591.
    Karasev, A.V. 2000. Genetic diversity and evolution of closteroviruses. Annu. Rev. Phytopathol. 38:293-324.
    Lai, M.M.C. 2000. The making of infectious viral RNA: No size limit in sight. Proc. Natl. Acad. Sci. U.S.A. 97:5025-5027.
    Lee, C., Calvert, J.G., Welch, S.K., and Yoo, D. 2005. A DNA-launched reverse genetics system for porcine reproductive and respiratory syndrome virus reveals that homodimerization of the nucleocapsid protein is essential for virus infectivity. Virology 331:47-62.
    Moore, D., Dowhan, D., Chory, J., and Ribaudo, R.K. 2002. Isolation and purification of large DNA restriction fragments from agarose gels. Curr. Protoc. Mol. Biol. 59:2.6.1-2.6.12.
    Peng, C.-W., Napuli, A.J., and Dolja, V.V. 2003. Leader proteinase of the beet yellows virus functions in long-distance transport. J. Virol. 77:2843-2849.
    Peremyslov, V.V., Hagiwara, Y., and Dolja, V.V. 1998. Genes required for replication of the 15.5-kilobase RNA genome of a plant closterovirus. J. Virol. 72:5870-5876.
    Peremyslov, V.V., Hagiwara, Y., and Dolja, V.V. 1999. HSP70 homolog functions in cell-to-cell movement of a plant virus. Proc. Natl. Acad. Sci. U.S.A. 96:14771-14776.
    Peremyslov, V.V., Andreev, I.A., Prokhnevsky, A.I., Duncan, G.H., Taliansky, M.E., and Dolja, V.V. 2004a. Complex molecular architecture of beet yellows virus particles. Proc. Natl. Acad. Sci. U.S.A. 101:5030-5035.
    Peremyslov, V.V., Pan, Y.-W., and Dolja, V.V. 2004b. Movement protein of a closterovirus is a type III integral transmembrane protein localized to the endoplasmic reticulum. J. Virol. 78:3704-3709.
    Prokhnevsky, A.I., Peremyslov, V.V., Napuli, A.J., and Dolja, V.V. 2002. Interaction between long-distance transport factor and Hsp70-related movement protein of beet yellows virus. J. Virol. 76:11003-11011.
    Sambrook, J. and Russell, D.W. 2001. Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory Press, ~Cold Spring Harbor, N.Y.
    Satyanarayana, T., Gowda, S., Boyko, V.P., Albiach-Marti, M.R., Mawassi, M., Navas-Castillo, J., Karasev, A.V., Dolja, V., Hilf, M.E., Lewandowski, D.J., Moreno, P., Bar-Joseph, M., Garnsey, S.M., and Dawson, W.O. 1999. An engineered closterovirus RNA replicon and analysis of heterologous terminal sequences for replication. Proc. Natl. Acad. Sci. U.S.A. 96:7433-7448.
    Satyanarayana, T., Bar-Joseph, M., Mawassi, M., Albiach-Marti, M.R., Ayllon, M.A., Gowda, S., Hilf, M.E., Moreno, P., Garnsey, S.M., and Dawson, W.O. 2001. Amplification of Citrus tristeza virus from a cDNA clone and infection of citrus trees. Virology 280:87-96.
    Satyanarayana, T., Gowda, S., Ayllon, M.A., Albiach-Marti, M.R., and Dawson, W.O. 2002. Mutational analysis of the replication signals in the 3¢-nontranslated region of citrus tristeza virus. Virology 300:140-152.
    Satyanarayana, T., Gowda, S., Ayllon, M.A., and Dawson, W.O. 2003. Frameshift mutations in infectious cDNA clones of Citrus tristeza virus: A strategy to minimize the toxicity of viral sequences to Escherichia coli. Virology 313:481-491.
    Satyanarayana, T., Gowda, S., Ayllon, M.A., and Dawson, W.O. 2004. Closterovirus bipolar virion: Evidence for initiation of assembly by minor coat protein and its restriction to the genomic RNA 5¢ region. Proc. Natl. Acad. Sci. U.S.A. 101:799-804.
    Valverde, R.A. 1990. Analysis of double-stranded RNA for plant virus diagnosis. Plant Dis. 74:255-258.
    Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:10.4.1-10.4.8.
    Xiang, C., Han, P., Lutziger, I., Wang, K., and Oliver, D.J. 1999. A mini binary vector series for plant transformation. Plant Mol. Biol. 40:711-717.
    Yount, B., Curtis, K.M., Fritz, E.A., Hensley, L.E., Jahrling, P.B., Prentice, E., Denison, M.R., Geisbert, T.W., and Baric, R.S. 2003. Reverse genetics with a full-length infectious cDNA of severe acute respiratory syndrome coronavirus. Proc. Natl. Acad. Sci. U.S.A. 100:12995-3000.
 Key References
    Peremyslov et al., 1998. See above.

This paper describes generation of the fully biologically active cDNA clone of BYV and its tagging via insertion of the reporter gene encoding green fluorescent protein.

    Prokhnevsky et al., 2002. See above.

This paper describes generation of the binary vector designed to launch infectious viral genome via agroinfection that dramatically improved systemic infectivity of the cDNA clone.

    Chiba et al., 2006. et al., 2006. See above.

This paper describes the use of viral RNA silencing suppressors to drastically increase the infectivity of virus launched by agroinfection.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library
Looking for Answers?
Do you have tips, tricks, or improvements to share?

Join the Conversation

Post new comment

The content of this field is kept private and will not be shown publicly.
CAPTCHA
This question is for testing whether you are a human visitor and to prevent automated spam submissions.