User Ratings

Easy to Follow Achieved Expected Results Overall Rating Add your comments

Heat‐Activatable Primers for Hot‐Start PCR: Oligonucleotide Synthesis and Basic PCR Setup

Alexandre Lebedev¹

¹TriLink BioTechnologies, Inc., San Diego, California

Publication Name:

Current Protocols in Nucleic Acid Chemistry

Unit Number:

Unit 4.35

DOI:

10.1002/0471142700.nc0435s38

Online Posting Date:

September, 2009

GO TO THE FULL TEXT:

PDF or HTML at Wiley Online Library

Are you the author of this protocol? Login or register and return to this page.

Abstract

2¢-Deoxyribonucleoside-3¢-O-(4-oxotetradec-1-yl) phosphoramidites (OXT phosphoramidites) are used to prepare modified oligodeoxyribonucleotide primers containing heat cleavable OXT phosphotriester protecting groups at 3¢-ultimate and penultimate internucleotide linkages. The OXT-modified primers significantly improve performance of the polymerase chain reaction (PCR) compared to standard DNA primers by substantially reducing or eliminating the accumulation of PCR artifacts such as dimerized primers and misprimed amplicons. Basic protocols for synthesis of OXT-modified oligonucleotide primers and for performing hot-start PCR are described. Curr. Protoc. Nucleic Acid Chem. 38:4.35.1-4.35.17. © 2009 by John Wiley & Sons, Inc.

Keywords: PCR; hot-start PCR; primer dimer; mispriming; 3¢-phosphoramidite; phosphotriester; oligonucleotide; DNA polymerase

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Introduction
Basic Protocol 1: Synthesis and Purification of Oligonucleotides Containing 4-Oxotetradec-1-yl Phosphotriester Internucleotide Linkage(s)
Alternate Protocol: Desalting of OXT-Modified Oligonucleotides on SepPak Cartridges Using Water-Acetonitrile Mixture for Elution
Basic Protocol 2: Hot-Start PCR with OXT-Modified Oligonucleotide Primers and End-Point Detection
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Synthesis and Purification of Oligonucleotides Containing 4-Oxotetradec-1-yl Phosphotriester Internucleotide Linkage(s)

Materials

2¢-Deoxyribonucleoside OXT phosphoramidite S.4a-d
Anhydrous acetonitrile, synthesis grade
Dichloromethane
Molecular sieves, type 3Å, activated
Argon gas (dry)
Fast deprotecting 2-cyanoethyl deoxyribonucleoside phosphoramidite monomers (Glen Research)
Fast deprotecting OXT deoxyribonucleoside phosphoramidite monomers (Trilink Biotechnologies)
Cap A mixture: 5% phenoxyacetic anhydride in THF (Glen Research cat. no. 40-4212-52)
Controlled pore glass (CPG)
50 mM potassium carbonate solution in methanol (Glen Research)
1 M triethylammonium acetate buffer (TEAA), pH 7.2 (Trilink Biotechnologies)
Reversed-phase C₁₈ cartridge for oligonucleotide isolation (SepPak, Waters)
Washing solution 1: 25 mM TEAA, pH 7.2
Water, HPLC grade (Fisher Scientific)
2% trifluoroacetic acid (TFA) solution in water
Washing solution 2: 15% acetonitrile in 100 mM TEAA, pH 7.2
Washing solution 3: 25% acetonitrile in 100 mM TEAA, pH 7.2
DMSO (Sigma-Aldrich)
Mobile phase A1: 50 mM TEAA, pH 7.2
Mobile phase B: 100% acetonitrile
Mobile phase A2: 50 mM TEAB, pH 8.5
1 M triethylammonium bicarbonate buffer (TEAB), pH 8.5 (Sigma-Aldrich)

DeltaPak 15-µm C₁₈ (3.9 × 300–mm) analytical column (Waters)
DeltaPak 15-µm C₁₈ (19 × 300–mm) preparative column (Waters)
4- and 8-mL screw-capped glass vials
Rotary mixer
15- and 50-mL screw-cap plastic tubes
Speedvac concentrator equipped with condensation trap (e.g., model SC110, Savant)
UV-VIS spectrophotometer (Beckman, model DU640B or equivalent)
1-, 10-, 15-, and 50- mL plastic syringes
Mass spectrometer (Finnigan MAT LCQ mass spectrometer or equivalent), optional
HPLC system with diode array detector (System Gold, Beckman or equivalent), optional

Additional reagents and equipment for solid-phase oligonucleotide synthesis (appendix 3C) and RP-HPLC (unit 10.5)

Alternate Protocol: Desalting of OXT-Modified Oligonucleotides on SepPak Cartridges Using Water-Acetonitrile Mixture for Elution

Additional Materials (also see Basic Protocol 1)

1.5-mL plastic tubes

Basic Protocol 2: Hot-Start PCR with OXT-Modified Oligonucleotide Primers and End-Point Detection

Materials

10× MgCl₂-free PCR buffer, pH 8.4 (Invitrogen)
50 mM MgCl₂ solution (Invitrogen)
10 mM dNTP mix (Invitrogen)
2.5 U/µL Taq DNA polymerase (native or recombinant)
Template DNA, e.g., 1µg/mL bacteriophage -genomic DNA
50 µM standard DNA primer 1 at 50 pmol/µL in water (store at –20°C)
50 µM standard DNA primer 2 at 50 pmol/µL in water (store at –20°C)
200 µM singly OXT-modified primer 1 at 200 pmol/µL in DMSO (store at –20°C)
200 µM singly OXT-modified primer 2 at 200 pmol/µL in DMSO (store at –20°C)
200 µM doubly OXT-modified primer 1 at 200 pmol/µL in DMSO (store at –20°C)
200 µM doubly OXT-modified primer 2 at 200 pmol/µL in DMSO (store at –20°C)
DMSO
Mineral oil (optional, Sigma)
Water, biology grade or HPLC grade (Fisher Scientific)
50-bp DNA ladder diluted 1:50 with HPLC water (Invitrogen, cat. no. 10416-014)

0.2-mL thin-walled PCR tubes
Microcentrifuge with PCR tubes rotor (Cole Parmer, K-17310-00 or equivalent)
Automated thermal cycler
E-Gel powerbase v.4 and pre-cast 4% agarose gel (Invitrogen, cat. no. 6018-02)

Additional reagents and equipment for performing agarose gel electrophoresis (e.g., Voytas, 2000)

Looking for materials? Suppliers Guide

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 4.35.1

Structures of singly (S.1 and S.2) and doubly (S.3) OXT-modified phosphotriester oligonucleotides. B, thymin-1-yl, cytosin-1-yl, adenin-9-yl, or guanin-9-yl.

View Image
Figure 4.35.2

Structures of OXT phosphoramidite monomers S.4a-d.

View Image
Figure 4.35.3

RP-HPLC analysis of doubly OXT-modified oligonucleotide S.3 after standing in PCR buffer for 5 min at 95°C. Peak identification: 5 – unmodified PDE oligonucleotide S.5, 1 – singly OXT-modified oligonucleotide S.1, 2 – singly OXT-modified oligonucleotide S.2, unidentified compound U, 3 – doubly OXT-modified oligonucleotide S.3. Chromatographic parameters: DeltaPak 3.9 × 300–mm C₁₈ analytical column; mobile phases A1 and B, gradient of mobile phase B (0% to 100%) over 40 min, 1 mL/min, detection at 260 nm.

View Image
Figure 4.35.4

Heat-induced conversion of doubly OXT-modified oligonucleotide S.3 to unmodified S.5 (activation of the OXT primers in PCR buffer). B, thymin-1-yl, cytosin-1-yl, adenin-9-yl, or guanin-9-yl.

View Image
Figure 4.35.5

(A) 4% agarose gel analysis of the PCR amplification of a 533-bp fragment of -phage genomic DNA using OXT-modified and standard PDE primers (see Table 4.35.1). Lane assignment: 1, DNA 50-bp ladder; 2, S.5 PDE primers; 3, S.1 OXT-modified primers (RP-HPLC purified); 4, S.3 OXT-modified primers (SepPak purified). Primer 1 and primer 2 sequences: 5¢- d(CAGGAGCTGGACTTTACTGATGC) and 5¢-d(CAGGAGCTGGACTTTACTGATGC), respectively. (B) Integration of UV-bands corresponding to the 533-bp amplicon (open bars) and dimerized primer (black bar): 1, lane 2; 2, lane 3; 3, lane 4. PCR conditions: 50 µL of 1× PCR buffer (20 mM Tris×Cl, pH 8.4, 50 mM KCl, 2.5 mM MgCl₂), primers (0.5 mM), dNTPs (0.2 mM), -phage genomic DNA (500 copies), and Taq DNA polymerase (1.25 U). Thermal cycling sequence: 1 cycle: 10 min at 95°C; 35 cycles: 30 sec at 95°C, 30 sec at 56°C, 30 sec at 72°C; 1 cycle: 5 min at 72°C.

View Image

Literature Cited

Literature Cited
	Ailenberg, M. and Silverman, M. 2000. Controlled hot start and improved specificity in carrying out PCR utilizing touch-up and loop incorporated primers (TULIPS). Biotechniques 29:1018-1024.
	Ankenbauer, W., Heindl, D., Laue, F., and Huber, N. 2006. Composition and method for hot start nucleic acid amplification. U.S. Patent No. US 7122355.
	Ashrafi, E.H. and Paul, N. 2009. Heat-activatable primers for hot-start PCR and hot-start one-step RT-PCR: Endpoint and real-time PCR experiments. Curr. Protoc. Mol. Biol. 15.9.1-15.9.15.
	Barnes, W.M. and Rowlyk, K.R. 2002. Magnesium precipitate hot start method for PCR. Mol. Cel. Probes 16:167-171.
	Birch, D.E., Laird, W.J., McKinney, N., Wong, J., Young, K.K.Y., Zangenberg, G.A., and Zoccoli, M.A. 1996. Simplified hot start PCR. Nature 381:445-446.
	Bonner, A.G. 2003. Reversible chemical modification of nucleic acids and improved method for nucleic acid hybridization. U.S. Patent application no.US2003162199.
	Brownie, J., Shawcross, S., Theaker, J., Whitcombe, D., Ferrie, R., Newton, C., and Little, S. 1997. The elimination of primer-dimer accumulation in PCR. Nucleic Acids Res. 25:3235-3241.
	Chou, Q., Russell, M., Birch, D.E., Raymond, J., and Bloch, W. 1992. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20:1717-1723.
	Dang, C. and Jayasena, S.D. 1996. Oligonucleotide inhibitors of Taq DNA polymerase facilitate detection of low copy number targets by PCR. J. Mol. Biol. 264:268-278.
	D'Aquila, R.T., Bechtel, L.J., Videler, J.A., Eron, J.J., Gorczyca, P., and Kaplan, J.C. 1991. Maximum sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19:3749.
	Erlich, H.A., Gelfand, D., and Shinsky, J.J. 1991. Recent advances in the polymerase chain reaction. Science 252:1643-1651.
	Horton, R.M., Hoppe, B., and Conti-Tronconi, B.M. 1994. AmpliGrease: ‘Hot start’ PCR using petroleum jelly. BioTechniques 16:42-43.
	Kaboev, O.K., Luchkina, L.A., Tret'iakov, A.N., and Bahrmand, A.R. 2000. PCR hot start using primers with the structure of molecular beacons (hairpin-like structure). Nucleic Acids Res. 28:e94.
	Kaijalainen, S., Karhunen, P.J., Lalu, K., and Lindstrom, K. 1993. An alternative hot start technique for PCR in small volumes using beads of wax-embedded reaction components dried in trehalose. Nucleic Acids Res. 21:2959-2960.
	Kellogg, D.E., Rybalkin, I., Chen, S., Mukhamedova, N., Vlasik, T., Siebert, P.D., and Chenchik, A. 1994. TaqStart Antibody: “Hot start” PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase. Biotechniques 16:1134-1137.
	Kermekchiev, M.B., Tzekov, A., and Barnes, W.M. 2003. Cold-sensitive mutants of Taq DNA polymerase provide a hot start for PCR. Nucleic Acids Res. 31:6139-6147.
	Kong, D., Shen, H., Huang, Y., and Mi, H. 2004. PCR hot-start using duplex primers. Biotechnol. Lett. 26:277-280.
	Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 15.1.1-15.1.14.
	Laird, W.J. and Niemiec, J.T. 2003. Amplification using modified primers. U.S. Patent No. US 6794142 (September 21, 2004).
	Lebedev, A.V., Paul, N., Yee, J., Timoshchuk, V.A., Shum, J., Miyagi, K., Kellum, J., Hogrefe, R.I., and Zon, G. 2008. Hot start PCR with heat-activatable primers: A novel approach for improved PCR performance. Nucleic Acids Res. 36:e131.
	Levina, A.S., Nevinskii, G.A., and Lavrik, O.I. 1985. E. coli DNA polymerase. A study of the mechanism of primer binding using oligothymidylate analogs with ethylated internucleotide phosphate groups. Bioorg. Khim. 11:358-369.
	Miller, P.S., Annan, N.D., McParland, K.B., and Pulford, S.M. 1982. Oligothymidylate analogues having stereoregular, alternating methylphosphonate/phosphodiester backbones as primers for DNA polymerase. Biochemistry 21:2507-2512.
	Mizuguchi, H., Nakatsuji, M., Fujiwara, S., Takagi, M., and Imanaka, T. 1999. Characterization and application to hot start PCR of neutralizing monoclonal antibodies against KOD DNA polymerase. J. Biochem. (Tokyo) 126:762-768.
	Moretti, T., Koons, B., and Budowle, B. 1998. Enhancement of PCR amplification yield and specificity using AmpliTaq Gold DNA polymerase. BioTechniques 25:716-722.
	Mullis, K.B. 1991. The polymerase chain reaction in an anemic mode: How to avoid cold oligodeoxyribonuclear fusion. PCR Methods Appl. 1:1-4.
	Nevinskii, G.A., Frolova, E.I., Levina, A.S., Podust, V.N., and Lebedev, A.V. 1987. Prokaryotic and eukaryotic DNA polymerase. I. The role of internucleotide phosphate groups in the binding of a primer with the enzyme. Bioorg. Khim. 13:45-57.
	Riol, H., Lévesque, G., and Murthy, R.V. 1994. A method of using heavy mineral oil for performing “hot-start” amplification of rare nucleic acids. Anal. Biochem. 221:210-212.
	Shigemori, Y., Mikawa, T., Shibata, T., and Oishi, M. 2005. Multiplex PCR: Use of heat-stable Thermus thermophilus RecA protein to minimize non-specific PCR products. Nucleic Acids Res. 33:e126.
	Ullman, E.F., Lishanski, A., and Kurn, N. 2002. Method for polynucleotide amplification. U.S. Patent No.US 6482590.
	Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1-2.5A.9.
	Weinfeld, M. and Livingston, D.C. 1986. Synthesis and properties of oligodeoxyribonucleotides containing an ethylated internucleotide phosphate. Biochemistry 25:5083-5091.
	Wilk, A., Chmielewski, M.K., Grajkowski, A., Phillips, L.R., and Beaucage, S.L. 2001. The 4-oxopentyl group as a labile phosphate/thiophosphate protecting group for synthetic oligodeoxyribonucleotides. Tetrahedron Lett. 42:5635-5639.
	Will, S.G. 1999. Modified nucleic acid amplification primers. U.S. Patent No. US 6001611.
	Zon, G. and Lebedev, A.V. 2007. Chemically modified oligonucleotide primers for nucleic acid amplification. U.S. Patent application no. US 20070281308 (December 6, 2007).